Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ530677
Length 539 bp
Fasta Format > rwhec15l05
acacatacatcccttgaacaatcaaactaggcaggttcacaaaccctgtg ggcatggcatcaaaattactgcggcaataggacaatgtcatttctggcga gcaacagggtaaagaagatctaatcgaagagggagaagccaaggtcatcc tcgctctcctccttctcctcttccttcttctcctcagccttgggggcctc tgcggcagctccacctgatgcagcggcaccaccaccaccagcaccaccac cgatcggaccagcagaggcaccaccaatgaccacctggaagatggcggaa ttgggggagaccatggtgaaggaggactggacgccgccggacttgtcctc ggcgcaggcggcggagacgagctggcgctgcaggtcgtagggcgtggcgg cggaggcctcgagctcgcccttgtgctgcttggccgaccactcggcgccg gagtcgcggcacacgaaggtgaagacgcccatgcctgcggtctctggagc gtgcggcggcggcgggggaggaggaggaggcgtctggan
Download
page-top