Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ530659
Length 566 bp
Fasta Format > rwhec15k08
gtctgagtgtatctggtatatctggtacagagttgctcctagagttgtat ctgaggtcagtgccataggcatctggcctcgtatatatgcgggtggccgg atgagcatgcaagctctagtggccgaatggcacttggccgtgggtgtgtg cgtgagagtgtccatcatcctggatggatggatgaggcctccttttatag tgtgagatagcttagtatgtaagctatgtaggtatggtagctaggtaact agtggcatgggcaaaggcatggtgggtgtcatccttgtcccctgggtcac ttcataaatagtgcgaggggacaagtgatactatacatgatgactgagat gatgcatgaatagtgctcgggtacatccgtctcgtcgatgtcgggtcggg ctgcantcggcagccggctggttggcgtantcngcanccggcaanttggc ncantcngcanccnncantcngccngncanancanncnnacngnaanccn nnangancnnncnanaaccnncangatcnnncnnncnntcnnactnannn nntnnncnanccccna
Download
page-top