Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ530649
Length 552 bp
Fasta Format > rwhec15j16
taatcgccaagtcagcaaaacaagaaccagctgctgcctggctaatccac aacggctgtaattgctaggagatctactactggtaggtaggcagcagctg ccgctgtacagattaagctgctgcgtcttcttccctttccttgcgcattg ccacctctggtttagctgagtgaccaaaaaagatcgagatagccccggcc ggcctagtgaaagtcaaggaaaaggagaacataataccatccatatggat ttacagggacgatgatggatgagcatcgtagtagcagcagcagcagcagc agctaatagttactagtaagagctagctactgcaacactctagctatgtg agtagtactggcggtggttgtaggagctgcagcctcgatctcgatccctc gtggaggaaagatcagaagggcgccgagagcaccctctgcagggtcttcc tcaccggcaccgacacctccactgaagccttgagctggtcgtacttgagg cggagctgctcgttctcctcgcgcagctggtgcacctccgactcgatctg gg
Download
page-top