Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ530587
Length 559 bp
Fasta Format > rwhec15g10
tacacaccgacaaccgcctcaaaaaccaccaaatcaaagggatgagcaca tggcgccgcgccgcgccgagaaacaaactagcctaaccaacaggtggata cagagacccagattattcaaagtaaacacggctatggtggcgacatcctc cttgcaattaaaatgggggagctgctatacggcttactgcgccttggcga gctcggcgcggatctgcttggcggcctcgaccatgttggtgagggcgggc ttgacctcggcatacttgcgggtcttgagaccgcagtcggggttcaccca caggatgttggtgtcgagcaccgcgagcatcttgttgacacggtcggcga tctcctccttggacgggatcctgggggagtggatgtcgtacacgcccggg ccaatgccggcgccgtacaccacgccctcgcggaagacggagagaagctt ctcgtcggaccgcgagttctcgatggtgatcacatcggcgtccatgttga tgatggactggatgatgtcnttnaanttgnantancacatgtggntgtgn atctnnnng
Download
page-top