Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ530510
Length 711 bp
Fasta Format > rwhec15c09
atttgtcacttgagcatccaaaaggaatgcagaaattgcataatccattc aaaaggaaccatattaggacacggcgtagtagactggagacggctggcta acccatggtgcagcaaaggctaacaaagcagagttacatgacgaaattgt tgaagatcatacactacgtgctcatgatcttaacagaagcacaacaaaca aattcttttgccttgcagcaccactccatatgccagaacagaaaatctat cacgcctccaacgaaggttctgtaggtgcttcagcatcaccttcagcagc attgggatcatcgacaatcgtgacaccctcaagatccaagggacggccag tcatcggatgaatggggttcctgtcacgatgtccacccttccggcccatg gctagcaacggaggcggcggcagaacaccggcacggaagaggatacgctg cacgggatctgatggctgtgccccaacagatagccagtacttgacccggt cgaacttgagccccatcctcttgccaccatccttcccggggagcgggttg tagtagccgaggacctcgaggtgcttgccgtcgcgcggggagcggctgtc ggcggccatcacccggtagaagggccggttgcggcagccgaaccgcgcga gccggatccggaccaccatggtcgacgctttcttcttcccttcctcnccg ccggcctgcgg
Download
page-top