Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ530494
Length 519 bp
Fasta Format > rwhec15b11
atacaattcngacataatatactctaagcaacaaagaacagatatcacaa atgggggaaaggggagaaaanaaatcacaatgtacgctgctgcaggtttc ntagacagtggttctcaggcagcatgggcggctaaccaaaggggcaacaa ttaatttagataaactcctcccgtcttcatctacaaccaaaaaaatccca tctaaccccctccggtatttacacgaggggggcanatactcttgagcgcc natgatccgatcaagcanttgacgccgcactgccccatggcgacggcctt ctgggtgtcggatatgaacgggtcgatcttcacccacatngagggagaag atggaggcgaggaggatggaccaccacgatgacgatggtcggcgtgcggt tctgctttcccatgagacccttgaggaaggggtagagatggaggatcacc cagatcgagaagaanagctttccgaanagcgggccccangattggtagcc gctgttgatggcgtatgat
Download
page-top