Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ530493
Length 693 bp
Fasta Format > rwhec15b10
atggcatggtggtaatcaacaacttataagtacataaacagaaccgaaac aggtaggttcgccgagactctcttgatataatcagaacttgctgaagaac tcgcagatgtaatctgaaacctcattaggcttctcctggttgcagaagtg actcactccctccatgacaaccacatcctccagattcggcacgctcgctt tcaagccacccttgtgaatgtagtctttcacccccggtacattgtatgta acgtcaaggtccccaacgatgaattttgttgctacttttattggagctcc agtccatggtgcagaaagctcccaattcaagtccatgcatctgtagtagt taagccctcctgtaaaccctgtcttctcaaatttgtcttgggtagaatag gaggagctggtttgcgcattccaaagaccgtcttaaacttatgactattg tcgtatagagcaaattcggcttcagcgactccaggctcctggaaacggca catgtagtggtcttccccgcacaaggccctgatgacctggagcgggctcc cctcggagctgcgcgggtggtaggccacgctgaggttaacgagcgcccgc acaaggtccggccggagcaggcagagctgccatgccacgagtgcgcccca ntcgtgtccaaccacnaacacctggggctgancctcntgccga
Download
page-top