Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ530490
Length 603 bp
Fasta Format > rwhec15b07
gtggactaaggacgtgtcaccctacacatactcctatataacatgacgca acaaactaaagaaaaataataagaaaaagctaagccaaaatatctatgct agcttggagtagtgctactgtctctgcatgctgagctccctgcggaagtt gccgatgaacctctccgtgttggcaaacagctcctcccgactcatcttca cgtccccgtccatgtcgacttcacaatcttcctcctcctcctcctcctcc tcctggcgtgccttttcctcttcgccggcttgctggccgccgttcagcga gctgaggaagaagatgctcgccgtcgacgggcactttttcagcaccttca gcaccacctccttggtcttggtcttcagctcgaatatattactcgccaca aaggcaggcaccacgacaagatcacccagaaccgccgcccgttcgtcggg acggactgattcagctccagccctctggaacggcgaggcctcgacggcct gaccggcactcggagacccgtgccggtcttcgtcgtcggngatggaancg ccgccgccgccnacnaangnctggatgncnanngcnaggacnatgccnnt naa
Download
page-top