Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ530457
Length 764 bp
Fasta Format > rwhec14p11
tggcatcacgcgccaaggttaggttagctaccagttactactatatccgt aggcctgctggagtcggaccgcaggaacccgcttcaactcatcgtcatca tcgagcaggaaccatacgagatactactacttcatgacatcattaagagg cggaaaccaaaacaacaacagtcttgcagactccagaaaggcacttgtcc agtgaactcttcaaaacgactctcctcaagtaagcattagtgagtgattt ccttctacccatatcaagctgtttcttccatctcatcatcagactgtgga ttctccacctcgctaccactgctcatgccattggtagcagcagacgagaa gtaatccttaaccgagctatcttcagccttgtacttcacaaacttcacaa ctgctgcgtcttcatttccacaatccttccttttccttatgccgttcgcc gtcaccttcatggactgagcggcagccatgaaagcattatcagctgtctc catctccacggcttcttcatcctccccaccttctgtgtgcataccctcct ggtgactctgcttgtcaatgaagaaaaggccagcgtctgagtgacccatc ctgctctgatagtgatagtcattcttggcatcatcatgcatcagcctctc cctgatccttgaacagttctctccaaacactgtgagccccttgtcttcaa gatctacaagccacttcagaaaagcttgaggtgtgatagcaactggtttg ccgagttggtcagt
Download
page-top