Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ530277
Length 614 bp
Fasta Format > rwhec14d21
agttctggagcctacacaaagagtttaggtaaattttttttttgattcat cagccatggtgaagctactagctagcgcgcgcattacttccacttcttga acttgccgccgccgccnaacatgccgtgcttcccatgcttgccgtgcttg aacttgccgtgcccgtgcttcccgtgcttgaacttgccgccgtggtggcc gtacccgccgccgtagcctccatggccgcccatcatgcctcccatcatgt gtccacctccaccgtggctgccgtgananatcttgtgtgctccgtaggcg gcggcggcagctgctgcgcctccagccagcatgccgcccatgcccatgcc tcctcctccatggctaccactgtgaccgnatgagccagggnagccggcag ggggatagccatgctgctgtggagggtagccatgctgctgcggggggnag ccatgctgaggagggtacccttgttgtggagggtatccatggccaccaaa tgggtacccatgaccaccaaacgggtacccatgaccaccaccatgagcac cggcaacgccgtgcatgatgttggaaagganccccttctccccatcangg cctcccnntccang
Download
page-top