Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ530275
Length 777 bp
Fasta Format > rwhec14d19
catctggtttctcacaggtctgaacttctcctaaaaataagcaacatgat tggttatactcaacccatggaacatgtagcagagatctttagcccagcat tgattaccctttgtatgcaatacagaaactatcgattagaacttccagaa caaagctttgatccaacattcttggtcacacttgctggaggatcaacaaa attatgttcactgggtgtcgctgccctctcccatctctttgcaggaaact tcttgttcggaaatcatctggtggcctttgacggactagccgaggaggag agaatgaaacgacaggttgatgagcagcagaaggagttgcatcagcaaga gcccgctcatctgccggtccagtattgtccctttggacatggaaccacag tccatcctttggtgcgcctgaccctgacagtcatcaaaatgaaattctaa agaatattgactccattgaaaatggattttcttaaccctgctgggagtag tgcctgtaaacttcatggcttcctgcaaatttatgtagagggggcgatac tgaagagctccagcagcgaaggcctggttgccgaccatcgtggtgggagg agatgcagaccacatcaacaagcaagtcaacagtcaacgtancctgacac cgagaaccaccancaacgctgcacgacgaccgcccgcgacgctgcacaac tgctctggtgctgcgaatcgacgaccacccgcgaccctgcacaactgctc cggngctgcgaatcgaccaccacccnc
Download
page-top