Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ530237
Length 710 bp
Fasta Format > rwhec14b16
tactcggatcacaacagatacttttaattggagaaacaattgaagatgaa cgagaaacagagcgtgttctataagcagcaagttatgaagcgtgccagaa cacgcaccacaaatacaaccaccaactagaaatgatgccgctctggatac attcgtccatcgcaaatcatttcaagtgtgtttttatcaagcaaatggtt ttcgattaggcccaactatgacacggtgttattacatccataacagcgtt agcttgtcatgcgccactggcatacatacgagtccattccttcgctgtct caacagcttcagcttcattggatttccagtgttttgcgacgttttctgag agaggatcatctgggtttggggcgctcagcagtgcctgaatgctcaaaag aacagtgcgtatctgaagagctggactccacttgtcctttaggatgtcga ggcatattctaccaagcttgtcaatgttgggatggtatatttttgtgaga aacctaactttaggagcagccatcggatattcctcgggtaagaaaagttc aagcttgaagactccaccttcgtagggcgactgcgcggggccaaggacca tgacattgaagtancgcatgttctcctccgacggcgaggcgctgatcccg ggcgctggctcgctgancanccgctgcgtctccttgatgatccggcgggg gaggntnctg
Download
page-top