Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ530189
Length 753 bp
Fasta Format > rwhec13o22
cacttgaagtcttaggctttcgcattagcactctggaagctacagccttt gccacaatagttgccaaagaaaattagcgcacaccctcaatggtgccaga gctgaagtaaaccacagatctttcaatggtagaatgtcaagagtgagtgt ggtcagaggaaaatgccatctctttcgctgatccagccgtgctgctcttc ttactatgttgaaaccgcaacggtgccctcaggaagagcagagatgtgca caacaggtgtatgcgattttaatggtatgtcggagccggtaaccttcttc tccgtcgacctgctcagcaccttcctcacctcatccgcaagcacaatgat cgagtcgtcttcatggcttatattggacagtgccttctccattgagaaca ggtagtccctattatatccattagggccactggctgtagcaatttgcctt gccatatcctccaaagcagcagggccaagatagtatttgttgccaactgg atcaggagtggatacgaaaactaatacatccgtcacagctggttccagag aatttccatccttgtagaaatccacagagatcttctggtcatactcgcat tctcttctctccaagtactgcattgcttctcgctctttttctagaccacc tttgacacaataagcaattccccagcatatggcttcatcttcggattcaa gggttgcaggtcctggccggatgctgtggtgtgcctctatggtcaatgca agc
Download
page-top