Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ530155
Length 712 bp
Fasta Format > rwhec13m24
acacataacgaactgttcacgagtaccacaaacagctagccgcgcttaat gtttggccagncaaaagacaaaaccgatacagctaaacgtgccanaacca tccaacgatcgacactaaagataaaaacaactaagcggtgcagggcatga anatccgacnacaggnanacttggcgcttantcnacctcctccatcttgc tctcaccagcgtcatcctccaggggcggcatgtcggtgtcgttctcaggc gcctcatcgtcctcgncnatgctcaggccaagcttgancatgcngtggat cctgntgccaaaggtgttggggtcctcaaggctgaagccggaggtgagca gggaggtctcgaagagcagcatcaccaggtccttgactgacttgtcgttc ttgtcggcgtcggcgcgcttgcggagctcgtccatgatggcgttctcagg gttgatctccatggtcttcttgcttgacatgtagccagccatgctcgagt ccctcaaggcctgggccttcatgatcctctccatgttggcggtccaccca tactcgccagtcaccanacagcaaggggagtccacaacacggtcanagac gatgaccttctccaccttgtcgcccagcacctccttgatgaccttgcaca ncccctcnaacttctccttgagctcctcctgcttcttcttctcatcctcg ctctcatcnanc
Download
page-top