Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ530154
Length 161 bp
Fasta Format > rwhec13m23
atccgttacatcaccagacatcaaaacatagttcccagtatcacgacaag taggtcataacagcaagactcatcgatacaaaatagtgcagctctcttta acaacacaagaccaggtaagggataacagcaccaaaaatttagagcttgt cctcgaaatcg
Download
page-top