Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ534001
Length 718 bp
Fasta Format > rwhec8l03
aattcagtagcaattccacctatcttgacaaatcatacaatataaagtaa aaaaaaaagatccacaatattgattaactgggcccacgtaggnggaagat tacatttttctgggtacaagttgaagaaagccgcacttactagttcaaaa atgaggngcatgctgcactataaaacactatactaatcttaccagcagaa gaataccctttaataccgaatgtggnggattttccgtagatgattggttt atgtatcaactatggtacagggatgcttttgcagcttggtggaggcagcc acacaaatgattttctgtagatggttgttttattatgtatcaactacggt aagagatgcacaagctgcagccacacaaatgatacatagccatctgagct tcggagatgatcctatgtgcattgtaccaaacaaacaggatccacttccc tcagcagaggctcggataaaattgggaagaacccttcaaggattcaacat catcaattgcagtccatgactgctcttgcagcttggcagcctcagcaata tccgagttgcaaccatacacatgtattgccaatcgtctacgtgttggaga agatgatcttatgtaggtattgtaccaactgatgacgtcctccttcccaa ctgtccttagctcttcagcttccagttttgacatatcaaacatatacctt ttgtcggtaatctgcgac
Download
page-top