Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ533369
Length 309 bp
Fasta Format > rwhec6a20
tatgtcagatccnctaatntcaagngctttcgaaaaggaactctcatcag taaaatcnatgtaagctatccctttgcttgcacnattctcataatccatc ggaactgagacacgtgtgatttctccacatttagagaagtgttcttgaag agagctccgaatagcatcctcctgttgagatgaatcaaaacccttgacaa atactgagaggctgggacctccacttggttttccaaacgatccaccatcc ctggtgcgaggagttgcacctctttcancagccatgtcaagtctcaccgg acggnccat
Download
page-top