Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ291687
Length 699 bp
Fasta Format > whsl24e23
cggcggcggcgcagcgcagcttgaggaaggaagcgaagatggtgaagttc ctgaagcccggcaaggcggtgatcctgctgcagggcaggtacgcggggaa gaaggcggtgatcgtgcgcgtgttcgaggagggcacccgcgaccgcccgt acgggcactgcctcgtcgccgggctggccaagtacccgaagaaggtgatc cgcaaggactcggccaagaagacggccaagaagtcccgcgtcaaggtgtt cctcaagctcgtcaacttcacccatctcatgcccacccgctataccctcg acgtcgacctcaaggaggtggcctccggcgcgcccgactccctcacctcc aaggacaagaaggtgggcgccgccaaggccgccaaggccaagctcgagga gaggttcaagaccggcaagaacaggtggttcttcaccaagctccgcttct aggccggccggccgcgccagggcggtctctgccgttattactacccgaac cctttacatttttagttgcttgttatcggtgactgttgctgcgcttaagg tgtcctgttttggtattgcccatgaagaagactctgtgtttagcttggat cttatgagatatgatgatgtttcatgtgttaaatcatgtgaagaatagat ctttgttggaattttgttcagtgttattacttcttgagatatgctgtct
Download
page-top