Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ533198
Length 715 bp
Fasta Format > rwhec5g16
cacataacgaactgttccacgagtaccacaaacagctagccgcgcttaat gtttggccagccaaaagacaaaaccgatacagctaaacgtgccaaaacca tccaacgtcgacactaaagataaaaacaactaggcggtgcagggcatgaa catccgacgacaggcagacttggcgcttagtcgacctcctccatcttgct ctcaccagcgtcgtcctccaggggcggcatgtcggtgtcgttctcaggcg cctcatcgtcctcgtcaatgctcaggccaagcttgagcatgcggtggatc ctggtgccaaaggtgttggggtcctcaaggctgaagccggaggtgagcag ggaggtctcgaagagcagcatcaccaggtccttgactgacttgtcgttct tgtcggcgtcggcgcgcttgcggagctcgtccatgatggcgttctcaggg ttgatctccatggtcttcttgcttgacatgtanccagccatgctcgagtc cctcaaggcctgggccttcatgatcctctccatgttggcggtccacccat actcnccagtcaccanacagcaaggggagtccacaacacngtcananacn atgaccttctccaccttgtcncccancacctccttgatgaccttgcacan cccctcnaacttctccttganctcctcctgcttcttcttctcatcctnnn tctcatcnancttca
Download
page-top