Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ533077
Length 687 bp
Fasta Format > rwhec4p02
aacattatttggatccacaagacacgatccaactccaagcaggaacgcga tgccaagcgcgtacgtgattcatcgattaacttaggtggtgtagtccttg aggatgtcgagggtgagctcgctggcgtcggtggcctgcacgtcgatctg cacgccgtccagctccttcttgagcccctccgtggagctggcgtacagca tcttgttcctcgcgtccgccgactccggcgaccagtggatgaagaagatc ttgctgcggggggtctcgccggccgagtcctcggacacgaagtccaggtc gtagacggcgtagcggcagtcgtcggcgggcatggccgccgccaggtcgt cgaaggtggcgtcnagcgcgcccaccttgtccaccaccacctgctgcgcg tcntcgtccatcttgtacaccacnaaccggtgcttgcggtccgcccgcan ctcctggaacgccttcacncactcctcnttcaccgccactccngacacan anttcnccattgttgatggatctgnangttgncccnangaaaaaatctgt gtnctaaactgnaactgnnanctanattnaaanntnatgnntnnnncctc nnnncnaattcntnnnnnccnnnnnatcnnntannnntanannnnnnnnn nnnnnnnnnnanntnnnnnttttnnnnnnntnnnnna
Download
page-top