Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ532918
Length 763 bp
Fasta Format > rwhec4g23
agcaataacactcagtagtaatactacgaatcaactcgatctaaggtcca aaaacctcacagggcagatatgttatgcttgctttagctacgacaccatc acggcaacagaaaactgtagatatattgtgcgcccaccgccatcacctgc ctcaggaagatttagattttgttgaaggcaacaatgtcacagctctggat gtactcgttggctggttcaacgcagagatggtcttcaataagagtgtcga cagagacgaggtcatcaatgatggtcatcataatctggagcttcttgatg ccatatccaacgggcatgagcttggaagcaccccacagaaggccctccat cttgatgcttcggacagcttcctccagcttgaccatgtcggtctcatcgt cccatggcttaacatcaagcaaaactgatgacttgccagattctttcttc ttggtagaagcctttgctttggcagcgcgctcttcagctgcctttttctc ctcctcggtttcctctccaaaaaggtcaacatcgctgtcatcgtcatcat cagctgcaggagcctcagcaacatcagtagttgaggtttcagggacaact gatgacagaaccttcacaccttgaccaggggcagtaactccactcagctt caggagtgcatcaatgtgattgtaccaccttgcaacattggtgcnaagtt gatggtggagcaactganaactctgaatacncagccaagtcatccttgga agcttggtatcca
Download
page-top