Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ532754
Length 710 bp
Fasta Format > rwhec3n20
actcgcacgaccgcacaaaaagctacacatgtcaagtcatcttcaccacc accaccaatccgcttccttccttccttccttccaaggtacacttactata gtactagtagtaggatacatctcaaggaacaagagaaccacgattacacg ctatggcaaacacaaattatgatccaagatcgatcgatgctactaagggc ccaaaagaatacaatacagtgcttccttttctcctctccggtgcagcaag tcccttccttccttccttccttcctgcccagtcgttatcatacatacctt cgacaccgcttcgtcgtcttggtggcaacatggaagcttctgggcaggcg gtgttagatcctcagatgaatgaaaaactactgcaatgcaatgtacgtct gacaactgcttgttccagcatcgtctggtttcatagcaacccagctagca tggcacccgggtcgttatatgtcgccggcgctgctggaggcagctgtggt tgttgcggagcggcagggggggccactcgagccctcgggatgtcgatcag atgttccttgatgtactccttcaactcgaatgtcagattttgatctcctg atgcgactgttagccggagctgacttctgtcttggggatctgtttcaact ctcaccagacaaagcgcggcattggttgtctccgaaaagaatgtancaca cgccaccatg
Download
page-top