Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ532702
Length 240 bp
Fasta Format > rwhec3k05
agaacaatagccntaataacngtancantgataannaaatctctcacact gttctccataaagaanaaccctgggtcatgagaaaatgctccaccagtgg gttatgcccctatccattatgagcgntattatatttatgttgtccctttc ttgtgctaacnaaagtttcggtttgtcccaccanatgttaatcccncata gaacaggaaacatgattaatacngccttgtgntttgggtc
Download
page-top