Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529318
Length 668 bp
Fasta Format > rwhec10i19
ataacacttgaagtcttaggctttcgcattagcactctggaagctacagc ctttgccacaatagttgccaaagaaaattagcgcacaccctcaatggtgc cagagctgaagtaaaccacagatctttcaatggtagaatgtcaagagtga gtgtggtcagaggaaaatgccatctctttcgctgatccagccgtgctgct cttcttactatgttgaaaccgcaacggtgccctcaggaagagcagagatg tgcacaacaggtgtatgcgattttaatggtatgtcggagccggtaacctt cttctccgtcgacctgctcagcaccttcctcacctcatccgcaagcacaa tgatcgagtcgtcttcatggcttatattggacagtgccttctccattgag aacaggtagtccctattatatccattagggccactggctgtagcaatttg ccttgccatatcctccaaagcagcagggccaagatagtatttgttgccaa ctggatcaggagtggatacgaaaactaatacatccgtcacagctggttcc agagaatttccatccttgtagaaatccacagagatcttctggtcatactc gcattctcttctctccaagtactgcattgcttctcgctctttttctagac cacctttgacacaataag
Download
page-top