Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529275
Length 471 bp
Fasta Format > rwhec10f22
accacgcccggtttacacaactgttaaaaattgctcttttcataacacgc acacaacacctttttccacagcaatatcgctagtacatgatgtcatgatc ttacatgttaaacataccaagtccaccacttgagtatcctgctcacacat tgctttgcttgtacagcttcgtgtccagcacttgcttgccacacatcgca cacaccccttttgaataggcacaggtgtggcagtatttaccgtcctggtg cacctgttgcttgcagattatgcatttggtatttccgtaaggagtccacc tgctcttcttggagaggagcttgttctcgttgatcttgcggccgccgccc tcgtaggtgttgctggcgccctccttccacttgtccgggacgatcacctt ccccagcttcttctcgcacttggtgcacaccatcgccgccgccgccgccg ccgccggtgatcgggtttttt
Download
page-top