Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529272
Length 754 bp
Fasta Format > rwhec10f18
catctggagtgctcagtcaaaccagcacgacagggaggagggccgcctac ctagggttctagactagccgtctcaatgcttgtgagcgagctgcttgaga acattgccgaggtcggcctcgcccttggtgctcttgacccacttggcctt gatcctcaccctctcgatgctctgcttcaccgtcctcgcgatgctcgcct tggtcctgctcttgaagaactcctctgcctcgtcacccttctcgtccgtg gcgagcggtgagacagtgacggtgatgaaataggtgagcaggtgtccagt gaaggtctctgctatgtagtcccagttttccttcaaccatgtccatgcca cctcatgcgctgctgcagtcactccgcggagcacaaatatgcaatcctga ttccttacctcagacgatagcaggaaattcagcgcttcacgaacaacatc agggtcaggggacgatgccaaagaaccaagcacacggactttttcctggc tcagatcagtttccctgtaaatcttcaggagagattcatacccacttttg tttgacttgttcacggtctgcatcagtgcaacatatgcagcctttcggac atctggtgggaggagtggcgtctctctgtcttccagaaagacattaaatc gacggacagcctcgtctatggtanactgatggcctanttccgctaganca gataananggtacctcttaacagtgcattcaggtgacctccccactcttg gcat
Download
page-top