Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529264
Length 646 bp
Fasta Format > rwhec10f09
cactcccaacatcaaccaccctcactttggggcgttcctgatgcatcaca acagtatcccccgtctttcggggtttccccgctggcggcgggcatactgc actacaaatacataaatatgaagaagaacatacacatcaccgagattacg gacagacggcaccgacacagacaggctcacatctttagaggcctacttct tccgagtaccaggtcctttctgggggaaatgcaaccaccaaccaacagct tgcgctttcatggacgacggacgggacagatcattgtgaaaacatcttcc acaacttacagggatgatatttactaaaaagaaccacagagcaaccacaa acatgttccgaagcagatcaggcgtcttctgtcttgcacaggtctagcag tgacagtgtctctgctatggagagctcgaggcggaatttaggaccatcat agtggtgcagcactggcctgaaagcatcctcttccaaggccttgcaaagc cttctaatgcggatcctcacctgtgctgggaatctggattcacctttgca cttcttatcttcccaagcagtgggatcaatgtttgatcctccaaaactag cagcctcaaacaccccatgtagctgatgggtcgtgtagttgtagag
Download
page-top