Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529256
Length 395 bp
Fasta Format > rwhec10e24
acatgagtacaccagagtacaagcaatcctcatgacatagacgaaattga taacagagacagcatcctggaatcacttcctagcttgcataacaaacact aaaacgtccataaaacaaaatgcagataagtcttggaaccatggctcccc cacgcggcggtcggcaggtacggatctagaacccgagcttggtgcggcgc cagtgcctgcgcttcgcgttgtacctgatggtgttgtcggtccgcatgcg gatccagtaggggatggggcggttctggcgctgcttcttggccagcttct gcttgatgcggaaggtcttgtgggacggcatcgtcgcggcggagacgaag acgcggcagcggcttcggcggcggcggcggcggcgggagcaaaac
Download
page-top