Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529252
Length 574 bp
Fasta Format > rwhec10e19
acaggcctccacatgccctgccacttaatgtcgacaaaacgcactgacta ctatatctttgacagattgggccgtaagtttatgatgtcatgcccaaatt cgacaagcataaatacattaggtgtacaggtggacggtaaccataggatg atgactattcccaagtcgtctaccagttcaagaatcagagtcactttctg tatcggaatgcacgtcaaacggtctatttctgttcgtgtttgcctcaagt ggcggcatatcatcatcgtcgtcttcatcagagttctgctcttcctcagc ctgtgatgtcgttccttgtggccctgtcgcccacccattgggagttgact tgaagatagccggccattggccggatttctcgagggcgcgaacctggtcg tgaaagaggacccgtgacacgacacaggctatcttgcttccagattcgag agcctcgtccctgccactagcatccacaaccacgaaattcccgttcttga tccagaagctcttctggaacttggcggggaagagggcgagagacttgacg ccctcgccgtcggtgacctacaac
Download
page-top