Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529251
Length 764 bp
Fasta Format > rwhec10e18
aaaactgtctcagacaacaagtttaatgagtctacaaggcaaattctcga gttcagccagtaacacacctctggttgaacccctcggaaactgctgtaga gaattcaagattttattgtgcgagggggttgcaatgttatcattcacttc agttttgttactgcggcatgtatggcatctgcaagatggggtacagttct ggagctcaaaccggccatgctgatcctcccatcagatgtcatgtaaatgt gatattcttgcctcatgaaggctacttgatcactgttgagcccagtgaaa gtaaacatcccaatctgcttaatgatgtgggaccaatctccaggtgtttc cctgattttcagcgcattaaaaagctgctccctcatgctaattatcctat cagccatggccttcagctccagagtccattcgtcgaacatagcactgtcc ttaagtatggtagccacgatagaagcaccatgaagaggagggttcgaata cataggcctaattacaagcttaagttgactttcaaccttaacagctatat cagcactcccacaaacgatgcttaaagcaccaacacgctctccatacaat cccatgttcttggcgtagctttgagccatgagcaattcaccaccatcagc gacgaacatgcgcactgattgggcatctttgtcaaggcttccgcttgcaa atccttgataagcactgtcaaanaatggcagcaatgcttttgatctcata agctgcctgatctg
Download
page-top