Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529246
Length 714 bp
Fasta Format > rwhec10e13
gagcacatatatgtttctaggtgtgccacacaataaaaaatgaagtggtg ccacaaagggaggagtacatatgtttctaggtgcgtcacccaaccaaaaa gagcatacagtggcttatgtgccaaaacaaccaccaaaatgagcagcacg tgccaatgtcaccaggttcaacaaacaaggtacattacataaccactcca ccaacttaattgtaggtcttgcaaacattcaacagcttgtaggtgatcca agccttaacttgtagatcatccaaaccttcagaagcttgtagatcaccca acttaattgtaggtcttgcaaacattcaacggcttgtaggtgatccaagc cttaacttgtagatcatccaaaccttcagaagcttgtagatcacccagtg tatctttgggaaacaaagtgtattctctgcattcacagaaaaaagtgtat tccctgcctccattcaaacttctcctccgagcatgttgtagcctttgctt agctgctagtgactacttgtcatgtcataatacatggaacatataagaat cagtgcttcatgttattcttatgaaatagtaacttatattgagtaaaaac tagattggagataaaggaaccgtagaaaaccaacatattatactacctcc gtctcataatgtaagacgttttttgacaatacttacattatgggacagag ggagtaccatttaa
Download
page-top