Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529242
Length 715 bp
Fasta Format > rwhec10e06
accagattgaatccagtacatgagacgatcatcaaaaggtttcacaaagt atgagctagcagtatttagacgacagataataggccaaaaatttcgactc agccagaccagatgctacaaactgctctaacgaataggcagataggttat gtagagcttccttctctaggccttcctggcaatctgggactcagcctcct tcttcaccggctcttccttctccgacaagatcagctcaatgtggcatggg ttggacatgtaggggttgatgcgtccatgggcacggtaggtccggcgccg ctgcttctgggcctggttcacttggatgtgtgaaatgtagagagcatcaa catcaagacctttcacctcagcattgctctcagcattctttagaagatcc agaacgaacttagcagacttggcaggccagcgtccctgaccattgggctg acggttcttcacctgggctgtgcgtccaacaccacggcagtacctccgga aggggatggcttgcttgtgtgccaacacatcctcaaggtacctcttggcc ttgttgagcgacatcttcctcagggcaaacgctgtttccctagtgttctt gaaatgaacacgcaggtcccggcccatggccttggcggacttggtgggat tggcgggatccgtcnagtacttcaccatggctgcggcggngcannanana aggcancggcggcng
Download
page-top