Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529227
Length 313 bp
Fasta Format > rwhec10d01
acttggtacagattcaaggacaaacaggccacccacaatatgctgctagg agaagagaacacgagggttaaaaagacacccgtcacatacaagcttagaa cgaactaatcttcagcaaaagcttgttgctgaagaggcctagcccagtaa gcaacagcaacagtctcggaacaagacgctaacagtagccccttccagca tacgatctggtgatcacagacaagaaagatagacctcccattacctatgt cataagcaggtcgttcactccaaggtgaggagggcgcatggagaccctga cttcatgttcttc
Download
page-top