Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529225
Length 712 bp
Fasta Format > rwhec10c22
tacattatggtgacaagtacccactttggatgaataacaaggcgactcac cgaagatagcagaaaccatctgagacacacggtgttttaagacggagggc tcagtggtcacctcctgaagagttgcttctgctttcttggcccgctgcgt taaaacattcctttcttcaacccaagtctttttctccgccttaaagctgg tcttcaacttttctgattcagtcacactaaactagaatttcgactcagcc ttccgggtttcattttcttgagccaccagccgagtcttggcgtcgttcag ttgagattccaattcagcagtcgcagcctcatacttctggtgcatctgtt tcaccatttcaatttccaaatcatggatggagtgtacttgattgagataa ccagacaatacttcactactgctcaattgagcatagtgggagacatcaaa tttcactttccgtctctccatgacttcttgcttggcagaatgtctggcta acatagttgggtttcccggttcagtaaaaccagtgccagtgatcagaatg tcatcagcataagtctctggcaggttaagtaagctggacggttcagtagt tgaagggttaatgttggtttgatcaacagacaactcaggcatttcagttt gagtattggaagcaggatcttctcgttgttgttcacaggcttctggngca gaagcttgctgg
Download
page-top