Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529222
Length 561 bp
Fasta Format > rwhec10c16
agcacagctctgaattaagcgacagtcaaatattctgaactcagagtaaa ctgataggcgactacataggatctataataaggctactcaaactgcaaat tcttgatgacgaccatgagagacgatgaaaaagaaggtgtctacagcctc cttcctctcctgccgccctttctgcgagtgctgtcagtgggaacaggggt cacgtcctcaatgcgtccaattttcatgccagaacgagcgagtgccctga gagcggattgagcaccaggtccaggagtcttggtcttgttgcctccagtg gcacggagcttaatgtgcaaagcagtgatgccaagttccttgcaacgcgt cgcaacatcttgagaagcgagcatagctgcatatggtgatgactcatcac gatcagccttgaccttcattccaccagtaatacgaacaagggtctctctc ccagacaagtcagtgacgtggatgaatgtgtcattgaatgatgcaaagac atgagcaactccgaagacatgctccccttcacggacagcaggtccaagag taacattctcc
Download
page-top