Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529221
Length 655 bp
Fasta Format > rwhec10c15
cacatatttttatttagataaaattcaacaaaccaaactaaattagctat agaccaaccgacttccaggattatttgtaccctcatattgtaccccaaag aacaacactaagcgattgctttctgttttcactttcaaaactgctcatac gaaagccatcattgtttagtctttccggagttctagacttcaaggtactt gctggctgtgtggacatccttgtctcctcttccactgcagttgagaacca ccctcacaccatccggtagtgttgggcagagcttctccaggtaagccagc gcgtgggatgtctccagggcagggatgatgccctccagccgagaggtgcg cttgaaagcgtccaatgcctcctgatctgtcacactatcatattcagcac gtccaatatccctcaagaaactatgctcaggtccaacacctgggtaatcc aacccagcactgatggagtggggctcaatcacttgtccatcagcatcctg caatacataactcagagatccatggagaactccgacttcccccttcgtta atgttgcagcgtgcttgtcagtgtctacaccatgaccagcagcctccact ccaatcagtcttacatcctgatcatcaacaaactcatggaagagacccat ggcat
Download
page-top