Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529218
Length 707 bp
Fasta Format > rwhec10c12
catggacggaaagagtaaccatctaggtacaagcaggggcaccccgcgga agaggacatacaccctccaccactagggcatccccgccggcggcggcgcc aacagggagcgctatccgttatagcaggacaatgacaggaaaaaggtaaa acaacatcacgatgtgaagtgaaacttgggataattctagtggagatgga taggctccttatgacaccaccgcacacagctcaggtccgttctcgcacag cagctcccgacttgtccgccggagcagccttgacaagatgcgtcttcttc actcgtcatcgtcctcgtcctcatcgctgccctcatcgtcatcgtcgtca ttgatctccgacttggacttgtcagattcctcctcatcttcctcctctac ctccttggccgcagccttctttggggcagcagcagcagcgctctcgccct tgttgtaggcagcaatggccttgttgtactcgcccttgagcttgttggcc ttggccacatagggggccttttccgattcgctcaagctcttccacctctc accggccgctttgccgacggcggcgacggacttgttcttggggttcttct gcttgaactcctcgcggaactcgcccatgaagacgaanaaggcggatggc gccctcttgggcttgttggggtccttgccngncttgccttcttcccttgg nggccgg
Download
page-top