Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529217
Length 519 bp
Fasta Format > rwhec10c11
gtagtttagtacacactcgcacaaaccaaactctcaagacatgacataac attaaagtttaacgacaccgacacttagtttctcgggacataaattcaga aacatgaaataacagtgacatgcagcgtaaaaagcagtattgttgccatc ccccgaacttataaacttcaagcttcattgcttctgctccagcgaccagc aatagttatgcagaaccgcaaccaacaaaagagcacatcattttgctggg ctaacagtaggttgataataggtggacgcattgggattccaggaagcacc gcctcccagtacacctttggtatctcctcatagtttggcatcgtcgttgt gaccgcattggcgaaactcgcaagccagactccctctccagtgacctcac agccggaacaatggtggttgcagcacttatatatgctagcacactaaagc ccatttggcacttctatatgctgccctacccttcttgtacagtgcttcca tgtcattagccgcaatccc
Download
page-top