Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529214
Length 747 bp
Fasta Format > rwhec10c04
gcccaccagaacaagggcaagggcagacaggaaaaacatccggcttgact actccatatcaagccttcaacctaaaaccgactcgcatagtctctggctc tcaaagtattgattgataagacagactcatgatcctctctctactcgatc agatcgtcatcgtcatcaggcagtggctgtgccgctgcagccgcaagctc agcctcgtgctgttgctgcatggccaagtcgaaggtcacttccggaggct taagggccactgcttcgacgaagtggatgttgggatcaccagccagcttc ctagcaaggtaaaggaagggcttctcaaagttgtagttgctcttggcaga gatttcatagtactggaggttcttcttcctgtggaatgtcacctgcttgg ccttaacctgcctgttcttcacatcaaccttgttgccacacagcacaatg gggatgttctcacaaaccctgcacaagtccctgtgccacgtaggaacatt cttgtaggtcagccttgaagtgacatcaaacatgataatcgcacactgac catggatatagtatccatccctaaggccaccaaacttctcttgcccagca gtgtcccagcagtanaaacggatctttccacagttagtggtgaaatccaa cgggtgaacttcaacaccaatggtgggttcgtatttcttctcaaactctc cantganatgcctcttcacaatgtggttttgccantcccgccatcnc
Download
page-top