Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529207
Length 307 bp
Fasta Format > rwhec10b15
tgngttgaacatgtgataatcccagngacacacaatataaccacatactt tccatcatactacatatttcccgtttgcagcaactcaaccttcttcaatc atcncagnggaacacagggcatcaacatactaatacctattagagcaaaa cacacacacacncacacacacacacacacaanaagctactantgcccagc attacatcctanttgatttgacaaaacntttacnccttaacagtcanctt cacnttcnggnagttctatctccttttanatcgacntgaagncggantgn aaaatag
Download
page-top