Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529206
Length 665 bp
Fasta Format > rwhec10b14
gttagccggtgacaatggacggaaagagtaaccaaccatctaggtacaag caggggagcacccggcggcagaggacatacaccctccgccgccagggcac cacccccgccggcggcggcgccaacagggagcgctgtccgttatagcagg cagcgggacgacgacaagaaacaaaaggtaaaacaacatcacgatgtgaa gtgaaacttgggataactctagtggagatggacaggctccttatgacacc accgcacacagctcacgtcggttctcgcgcagcagccgctcccgcctttg tccgccggagccagcagccttgacaagatgcgtcttcttcactcgtcgtc gtcctcgtcctcatcgctaccctcatcgtcatcgtcgtcattgatctccg acttggacttgtcggattcctcctcatcttcctcctccacctccttggcg gccgccttctttggggcggcagcagcagcgctctcgcccttgttgtaggc ggcaatggccttgttgtactcgcccttgagcttgttggccttggccacgt anggggccttctccgattcnctcaagctcttccacctctcaccggccgct ttgccgacggcggcnacggacttgttcttggggttcttctgcttgaactc ctcncgnaactcncc
Download
page-top