Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529201
Length 593 bp
Fasta Format > rwhec10b04
ataagcctgacgcggttaactgagctaagcagctcaagagcatctaagcc gaattggagcccgaaagctcttgcatcaaaggctaagcatccatagagaa ccaggcgcaaaatctagagaagcacatcaaacctcacatactagaaccag gattctgcaaatcccaagagagaaaattcttgattgcttaaaacaaattc ggagaaacacaaaacatcaccgcgacgcctatctcgcccagttgtttagc tcttggtggtcttctccttggtcttctggatcttaagcaccttcttcaca atcttctgctcctccaccaaaaacgccctaatgatcctctccctgactgc aggaccagacagaacaccaccataaggacggttcacagtcctcctgttcc tcgacaatctggacctcttgtactcagtaggcctcaggtgtgggattcct tggatcttcttgccggtaaccgggcattttggcccactcgcccgcttctt ggtgtactggtagacaagcttcccacctggggtcttgacgacgcgagtct gattcgacttggtggcgtagctgtggcgctttcggtatgtcag
Download
page-top