Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529200
Length 718 bp
Fasta Format > rwhec10b03
tcgtcatacacaccatacaaggtttagtacaagaccaaacgaagtacaac tgcgatgaaaggaagattacatcttatcggaggcatcccaagctcctata cattatatttctacacctccnaaaagtggtaccatcagctcagtcatatc ccacaatcacgcaggacggtggacgatataactgttacaatactagtggt gctaccatcagctcaaacatctccgtagtaatcttcgtagagattacccc catgtcctggaagctggacgtgatcatctggaaacagtcgatcctgtgga gcctgcagtccatagggacacagatgtggcctgggaccaacaaatggtga cagaagaggtccatggggaggagtgatgccccctacatcacgacaatcca tatgatccagcagactagaccgcacggggtacagatcccgcatatccata tacccagcctgcacagcaggtgcaaaccgggtcaaagtgtcccagtgatc agaccgggagttgaaaagctccaatcgcaaggcacgattttcacggtcct tatcctcaagcatctgtgcggtagtgcgaagtancgagtcctcatgatga gagtcggtgtaaatagctgtgaaataaccttctgccccagggagtgacgc tggcatatancggaantcantgttccaaagcaagccanttctancccgca tatantcntcattgaata
Download
page-top