Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529199
Length 754 bp
Fasta Format > rwhec10b02
tgatccagggacaacatgcagttcactccaccggtcgctcggaacactac cacgagccgactttgaaacctctagcacaactacgacgaagctagcatta cagtacagtagataaacacgccgtggtggccacagcataagttaacagtg cccacacaagacggtggccagataacagttggaaatttcagcgtagcagc agcagggcattgggctcacccgctcaagcaagacctgaagcaattgaagc tcaagataacctctgcttcttcctagcaagattctcgaaaatagatttta catcatcagatgtaactggttttgatggatcaaaggattccataaaggat tgaaactcatttttcatgtcattgatgccactcagaatctctatcttctg aacatggttaagtgaattgatgaagttagcttcagctccttcctgctgct ccaacttcttctcccttttctgcttcgctatcttctcatattcctcaata gagtcctccttatcagtaagatgtgcaatgcctcgttgcgcatagaagtt ggtgcatgtcccacatttacacagggtctctctccagccttttgacatga aaaagggcatagttttctctgaatcagctgatgttgtatttatatccact cctatcttacagttgccacctgaattgtcacccaaaatggacttatctga agctgcatgtcttttgtacagttctcctcgacagaggtattttcaatgct ttga
Download
page-top