Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529198
Length 457 bp
Fasta Format > rwhec10b01
ttcatacgagttcaacaggggcacgacggcctcaaaagtccattcacttc gtcacggggtggggtgatacttttggctggttatttaggtgataacggtt ctggctcggcgcatccatggtcaccagctggccgtcaagctctagcccat ggcgtacttctgtgtccaggagcgcgccgtggactcatacttggccctat cagtcttgtacatgtgagcgatctcgggcaccagaggatcatcggggttc gggtccgtcagcaacgaacagattgacagcaggacctttgatatggtcaa agccgggctccactgttccttgagaatgtcaaggcaaatgctgccgttgc tgttgatgtttgggtggaacaccttggtgcggaaagagaccttcgggggc ttgaaggggtaatccggtgggaaatgaatgttcaccaaaaataggccacc ggtgaac
Download
page-top