Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529196
Length 639 bp
Fasta Format > rwhec10a23
attcaagagggcggggtaataacttgacaaaggtctatgatagtaggata ggaaacaaggctaggcagcacaactctatgtctatggcgtaatcaacttt caacgcttcccgccgccaccgccaatctttgggcccttggaacccttctg cacggcgcccttgcccccctgtgacttctgggacttggtcacctctgcct tcttggccttcttctcatccttggtcttcttgatacgctccttgatctca cggagagcggcttctcgggcagcatcacggacttcaggcttctcggccct cttcttctggataacttccagagtggcaccaacaatcgaccgtgagtacg gcttcttggtggtgcggcgcctcttcttggcagcctcagcatggatgtcc ttcttgtgctgcttcctgtacattgctgtccagcaaagctttgcaggctt caggcggttgtggaagtagcgcttgcattttgagttggcaaagaggaaaa cctgcgaatccgaacgaatgaacctgatacccttccctgggtaaatcttc tggccgctaaaacggcaaagctcggtcttcagaaccatcttctcagcctt agagaactttcacaagctcctaccttaggcgaggaggag
Download
page-top