Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529187
Length 217 bp
Fasta Format > rwhec10a11
actcgcgaggcgcgngtagaatagctgcttggagagctcctggcacttct ccacggagggaggctgcacgacgtactgcttgttcttctccatcgcctcc ttgtagtaggcgccgccgtgcttcgaggcgaattccgccgcctgcgccgc cttggtccgcagctgcgcgagcctcgccgccatcgccgccggaaccttga cgaaacgtcggcaagag
Download
page-top