Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ529185
Length 510 bp
Fasta Format > rwhec10a06
cccacagcccctggctgctatacatactggaccaatttagcgattgctaa ggcgcaacgtcctcgcacgttcgtagtcggatcgtcaaagtcgacttcca ccaaagcgaaatccaccatctcatcgaaagacgggacacctttgcctcta tcaaaaatcctacggaacctactctatttcccctatgttgtgcatcctct ctgttcttcagaaccatatactactatccacgtcgaatctgaaagacaga aaccacaacagtacaacaccgaaaccgtatgagccctgcgagttaagaag ctaacaaatcctacagaacctactcaatctttcccctgtgctgtccatca tctctgttcttcaaaaccacaccactatccacatcgatctgaaagacagg ccatctggcaagagccttatcagtcctcctcctcgtcggggcccaggaat gaggcaaaggacttgtgaagcgacttgtgaaaacaattgatggatttgtc accctgcaag
Download
page-top