Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ640646
Length 603 bp
Fasta Format > whec20k14
aagcaagaagtccgcggcccctactgtcgtggcgccggcggccgtcctta ccaaggggaaggccgggaagaagcgcgaagccgatgacgagatcaagaag gctgtaagcgcaaagaaacagaaggctgcgccggcaaaggcggtgcccgg gcccaaagaggccgccaagaaggccaagaagcagccgccgcccaagaagg ttgagagcagcagctctgaggagcagtcatccgagtccgaggaggaggag gttcctaagaagactgcaaagcctgtcaaacacgagtcttcagatgatag cagcgacgattcctcctctgacgaggaacctgcaaagaagccttctgcta aacctgtgaccccagctgccagcaacggctcaaagaaaggcaagcctgag agcagctcttctagttctgaggatgagtccgatgatgacgagaaacctgc tgctctggtaaagaaaacaccagccatcgaatctgacagctccgaaagtg actcagatgatagctcagatgaggatgttcctgccaagactcctgctgct gctgccaagaaggtagattcttcanacagttctgagtcggagagtgaatc tga
Download
page-top