Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ640424
Length 718 bp
Fasta Format > whec1l21
aatctagctatcccaccctctctccgtgagctagcccaccaccacaaggt ccacaactacagctaactcggtcgagatggctcgcactgcagctactaag ctcgtgctggtcgccctggtggcggcaatgatcctcgcagcctccgacgc ggccatcagctgcggccaggtgagctctgccttgaccccctgcgtcgcct atgcgaagggcagcgggaccagcccgtctggggcctgctgcagcggcgtc aggaaattggccggcttagcgcggagcaccgccgacaagcaagctacatg caggtgcctcaagagtgttgccggagggctcaaccccaacaaggccgcag gcattccctccaagtgcggcgtcagcgtcccctacacgatcagcgcatcc gtggactgctctaagatccactgatcgatttctggccgccatcatcgccg attatagttccagcgattgatgctgagtacgttgaggtctcacacacaca tatatacatatacatgaataaatgctctgatatgatctccatgtgagaga taggagtacgtacatcgagccagctttgcatagctggccactgttgtatc tattttgtatcancgtttgattgttcgttcactccctttgagcagacacg ggagtttgttgtactttgtacgatgtacgcttatcatatatggattataa attaatctaaaaaaaaaa
Download
page-top